Aminahassan001

Chapter 1 MB Buckingham ASCP New Version. Johann Friedrich Miescher - ANSWERDiscovered DNA 1869. Extracted a viscous substance from isolated white blood cells. Prepared nuclei of cells by adding pepsin. Chemical analysis of this substance found in nuclei ("nuclein") showed that it was 14% N and 2.5% P, different from other known biochemicals. Nucleotides - ANSWERBuilding blocks of DNA, 700 kilodaltons each. Consists of a 5 C sugar where the 1st C is covalently bonded to a N base,...

MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers. What are the 3 types of gel electrophoresis -ANSWER Agarose Polyacrylamide Pulse Field What is gel electrophoresis -ANSWER the separation of materials based on size and migration patterns when subjected to electrical forces in a resistive medium. which direction does the DNA flow in gel electrophoresis -ANSWER due to DNA being negatively charged, it will migrate towards the positive end What determines how far the DNA w...

MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C ...

ASCP MB Certification Study, Buckingham Ch. 13 Solution Packcongenital - ANSWER"born with"; having a genetic component Lyon hypothesis - ANSWERhypothesis stating that only one X-chromosome remains active in females. Barr body - ANSWERX chromatin; a structure visible in the interphase nucleus, formed by the inactive X chromasome autosomes - ANSWERnon-sex chromosomes; any chromosome except for the X and Y sex chromosomes polyploidy - ANSWERin diploid organisms, having more than two o...

MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) ANSWER- t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% AN...

MB ASCP Study Aids Buckingham Ch. 7 2023 Updated.Polymerase Chain Reaction (PCR) - ANSWERPrimer-directed DNA polymerization in vitro resulting in amplification of specific DNA sequences. Target amplification - ANSWERTarget: Specific sequences or regions that are detected in an analytical procedure. Amplification: Replication/copying Target amplification: replication of a specific target region of DNA. Template - ANSWERSingle stranded nucleic acid used as a guide for replication or synthesi...

SAFMEDS 6223 deck 2 well litic - answerTwo interlocking levels of verbal behavior emitted in one utterance, a primary response and one that gives more information physically resemble - answerformal similarity requires the response to ______ ______ the stimulus mand - answerA verbal operant where the speaker asks for or states a want or need codic - answerVerbal behavior replications where the response has point -to-point correspondence, but without formal similarity verbal operant - ...

Deck 1 for 6226 With Complete Aency celeration - ANSWERA standard celeration chart is ratio chart used for displaying performance ___________ and ___________. baseline - ANSWERA naturally occuring level of the target behavior prior to intervention is a_____________. steady state responding - ANSWERPerformance maintained after systematic session-to-session changes have become negligible is________________ ______________ ______________. steady state responding - ANSWERA pattern of resp...

Assessment 2 UPDATED VERSION.When the cause-and-effect relation between environmental effects and behavior can be determined, that relation can be altered to improve behavior - ANSWEROn a practical level, FBA is important for prevention of and intervention for problem behavior because: Functional analysis, descriptive assessment, and indirect assessment - ANSWERThere are at least three forms of FBA. They are: Functional Analysis - ANSWERWhich methods of FBA allow you to confirm hypotheses ...

Social Studies Test #1 with correct verified answers.Who invented the cotton gin? - answerEli Whitney Who invented interchangeable parts? - answerEli Whitney Who brought textile mills to the US? - answerSamuel Slater Who led a group of enslaved Africans to kill enslavers because he thought God told him to? - answerNat Turner What effect did Nat Turner's Rebellion have on other southern states? - answerIt enforced stronger slave codes in the southern states. What country did the I...