Aminahassan001

Certification Exam Cards(complete solution graded).When handling blood spots, one should A. be even more careful when handling blood than other body fluids. B. protect from cross contamination from other blood spots C. store at room temperature up to 24 hours D. store at 4 degrees C for up to 7 years - ANSWERB. protect from cross contamination from other blood spots In handling blood serum, one should A. store in eppendorf tube in refrigerator indefinitely B. separate from ce...

Molecular Diagnostics Chapter 13 Assessment.Oncogenes genes that cause cancer by blocking the normal controls on cell reproduction, oncogenes prevent apoptosis

MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics En polymorphisms -ANSWER mutations useful for mapping, determining parentage balanced polymorphisms -ANSWER just a DNA sequence difference, the phenotypic effect of which is counteracted by a second trait or polymorphism methylation -ANSWER usually cytosine in CpG islands, shuts down RNA transcription by adding methyl groups genomic impringing -ANSWER enzymatic addition of methyl groups to specific nitrogen bases in a pr...

Practice test questions for MBASCP updated version.Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: a. Dystrophin b. P53 c. Musculin d. C-myc - a. Dystrophin This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I - Type III What links codons and anti-codons together during DNA translation? DNA ligase Single-stranded binding protein Complementary base pairing GTP - Complementary base pairing ...

Molecular Diagnostics Chapter 4(Well Solved). gel electrophoresis -ANSWERS. Procedure used to separate and analyze DNA fragments by placing a mixture of DNA fragments at one end of a porous gel and applying an electrical voltage to the gel Is the anode positive or negative? What about the cathode? -ANSWERS. Positive, negative DNA/RNA are positively/negatively charged? They migrate towards anode or cathode? -ANSWERS. negatively, anode Do large or small size DNA fragments migrate faster?...

MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring Write the complementary sequence for the following DNA sequence 5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon...

Translocations Advanced 2023.t(1,13) - ANSWERPAX3/7 + FKHR (there are two of these) Rhabdomyosarcoma t(2:13) - ANSWERPAX3/7 + FKHR (there are two of these) Rhabdomyosarcoma t(11:22) - ANSWEREwing sarcoma, childhood neoplasms, EWSR1 t(x:18) - ANSWERsynovial sarcoma, SS18, reciprocal translocation ss18/syt—>ssx1/ssx2 t(9:22) - ANSWERPhiladelphia chromosome, CML (BCR-ABL activation, tyrosine kinase oncogene) t(15:17) - ANSWERacute promyelocytic leukemia PML/RARA t(8:14) ...

Molecular Diagnostics Chapter 5(revised edition).What type of restriction enzyme is commonly used in the laboratory? - ANSWERtype II, 4-6 bp recognition sites restriction map - ANSWERdiagram that shows the lengths of fragments between restriction sites in the strand of DNA If you cut a linear fragment of DNA with a restriction enzyme at three sites, how many fragments do you have? What about if you cut a plasmid at three sites - ANSWER4 fragments, 3 fragments How do you perform restrict...

ASCP MB III: Laboratory Operations Ae / lavender - ANSWER- tripotassium EDTA (7.5-15% solution) - virology, molecular biology studies light blue - ANSWER- Tri-Sodium Citrate - Prothrombin time (PT), Activated Partial Thromboplastin Time (APTT), Fibrinogen thrombin time and other blood Coagulation tests. green top collection tube - ANSWER- sodium heparin (freeze-dried) - immunology, virology studies yellow top collection tube - ANSWER- Acid citrate dextrose (ACD) - molecular biology ...

MB (ASCP) 2021 - Translocations, Diseases, Pharma, Polymerases, & more 2023.Chronic Myeloid Leukemia (CML) - ANSWERt(9;22) BCR-ABL translocation Ewing sarcoma - ANSWERt(11;22) EWS-FLI1 Acute Lymphocytic Leukemia (ALL) - ANSWERt(9;22) BCR-ABL p190 protein Follicular Lymphoma - ANSWERt(14;18) BCL2 translocation Mantle Cell Lymphoma - ANSWERt(11;14) bcl-1 translocation CCND1-IgH Burkitt Lymphoma - ANSWERt(8;14) MYC gene translocation Rhabdomyosarcoma (alveolar); Cancer/soli...