Loc c3 - Study guides, Class notes & Summaries

MB (ASCP) 2022 Questions and Answers Rated A Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ...

Acute Brain Injury - Answer- An injury to the brain that is not hereditary, congenital, degenerative, or induced by birth trauma Traumatic Brain Injury - Answer- An alteration in brain function, or other evidence of brain pathology, caused by an external force 2 Mechanisms *trauma impact * traumatic inertial forces Non-traumatic brain injury - Answer- Lack of O2, decreased nutrients to cells, exposure to toxins, pressure from tumor or blockage or other neuro disorder ABI Prevalenc...

MB ASCP CONNECT Questions and Answers 100% correct What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90...

Acute Brain Injury - Answer- An injury to the brain that is not hereditary, congenital, degenerative, or induced by birth trauma Traumatic Brain Injury - Answer- An alteration in brain function, or other evidence of brain pathology, caused by an external force 2 Mechanisms *trauma impact * traumatic inertial forces Non-traumatic brain injury - Answer- Lack of O2, decreased nutrients to cells, exposure to toxins, pressure from tumor or blockage or other neuro disorder ABI Prevalenc...

BKAT Study Set Questions with Complete Solutions Normal blood gases; pH - ANSWER 7.35-7.45 Normal blood gases: CO2 - ANSWER 35-45 Normal blood gases: HcO3 - ANSWER 22-26 Normal blood gases: PO2 - ANSWER 80 or above Normal vacuum pressures for suction? - ANSWER 120-140 mmHg What may a high pressure vent alarm indicate? - ANSWER Pt is biting on the tubing, excessive secretions in the tubing, kinked tubing What may a low pressure vent alarm indicate? - ANSWER cuff leak or the tubing is...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....

What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5%b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together = CPI (CPI x PP) / [C...

What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together =...

EEG BOARD Prep (Part 1) The basic unit for measuring current flow is: a. atomic weight b. Coulomb c. Volt d. Ampere d. ampere The basic unit of resistance is: a. Ohm b. Coulomb c. Ampere d. Volt a. ohm Which of the following is NOT a valid expression of Ohm's Law: a. R=EI or (R=VI) b. E=IR or (V=IR) c. I=E/R or (I=V/R) d. R=E/I or (R=V/I) a. R=EI or (R=VI) Which of the following is NOT a unit for measuring alternating frequencies: a. cycles per second b. volts c. hertz ...

EEG BOARD Prep (Part 1) The basic unit for measuring current flow is: a. atomic weight b. Coulomb c. Volt d. Ampere d. ampere The basic unit of resistance is: a. Ohm b. Coulomb c. Ampere d. Volt a. ohm Which of the following is NOT a valid expression of Ohm's Law: a. R=EI or (R=VI) b. E=IR or (V=IR) c. I=E/R or (I=V/R) d. R=E/I or (R=V/I) a. R=EI or (R=VI) Which of the following is NOT a unit for measuring alternating frequencies: a. cycles per second b. volts c. hertz ...