Small nuclear rna snrna - Study guides, Class notes & Summaries

During Drosophila development, sex-lethal and transformer are a. miRNAs b. siRNAs c. involved in RNA editing d. splicing regulatory factors e. transcription factors - answer-d. splicing regulatory factors The consensus sequence for poly(A) addition is a. G/C upstream of the poly(A) tail addition site. b. AAUAAA. c. TATAAA d. a and b e. none of the above - answer-b. AAUAAA. Which of the following statements is true? a. ATP powered pumps allow movement in the direction o...

Genetics final study guide intro to molecular genetics mls 400 oakland Genetics Final Exam Important definitions Base: pyrimidines & purines (C, U, T) (A, G) Nucleoside: base + sugar (phosphorylated to become a nucleotide) Nucleotide: phosphate group + sugar + base Sugar may be ribose (RNA) or deoxyribose (DNA - missing hydroxyl group) Antiparallel: 2 sequences have opposite orientation with regard to their 5’ & 3’ ends Complementary: AT/GC rule; purines bond to pyrimidines, and vice ...

Genetics final study guide intro to molecular genetics mls 400 oakland Genetics Final Exam Important definitions Base: pyrimidines & purines (C, U, T) (A, G) Nucleoside: base + sugar (phosphorylated to become a nucleotide) Nucleotide: phosphate group + sugar + base Sugar may be ribose (RNA) or deoxyribose (DNA - missing hydroxyl group) Antiparallel: 2 sequences have opposite orientation with regard to their 5’ & 3’ ends Complementary: AT/GC rule; purines bond to pyrimidines, and vice ...

Transcription - correct answerCells copy DNA to RNA Translation - correct answerCells use information in RNA to make a protein RNA splicing - correct answera process in eukaryotic cells in which segments of an RNA transcript are removed What are the subunits of RNA? - correct answerA G C U (uracil hydrogen bonds with A) What is the benefit of RNA being able to fold in a variety of shapes? - correct answerThe change in shape allows RNA to carry out various functions in cells, (in addi...

PCB 3023 Exam 2: Transcription and Translation Practice Questions and Answers (100% Pass) does the structure of the DNA (nucleosomes) impact the ability of the RNA polymerase to transcribe genes? - Answer️️ -- yes - tightly bound nucleosomes, it's harder to get to the DNA so there is less expression - DNA is more exposed when the histones aren't packed together so tightly dna transcription vs replication - Answer️️ -- replication synthesizes new (daughter) DNA - transcriptio...

Genetics final study guide intro to molecular genetics mls 400 oakland Genetics Final Exam Important definitions Base: pyrimidines & purines (C, U, T) (A, G) Nucleoside: base + sugar (phosphorylated to become a nucleotide) Nucleotide: phosphate group + sugar + base Sugar may be ribose (RNA) or deoxyribose (DNA - missing hydroxyl group) Antiparallel: 2 sequences have opposite orientation with regard to their 5’ & 3’ ends Complementary: AT/GC rule; purines bond to pyrimidines, and vice ...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....

What are the functions of the four main types of RNA? - Answer mRNA - Messenger RNA: Encodes the amino acid sequence of a polypeptide. tRNA - Transfer RNA: Brings amino acids to ribosomes during translation. rRNA - Ribosomal RNA: With ribosomal proteins, makes up the ribosomes, the organelles that translate the mRNA. snRNA - Small nuclear RNA: With proteins, forms complexes used in RNA processing in eukaryotes. (Not found in prokaryotes.) Describe the differences between DNA and RNA. - An...

BIO 120 3rd Exam: Intracellular Protein Sorting and Maintenance of Cell Compartmentalization Compartmentalization - Due to network inside the cell Eukaryotic Cell Compartment Assembly of organelle depends on protein transported to it Highly regulated, specific and targeted Intracellular Compartment Nucleus continuous in cytosol (topologically continuous) o Molecules can move from one place to another without crossing the membrance Secretory and endocytic network o Vesicles, endoso...

Nucleic Acid - correct answer A polymer (long repeating chain) of nucleotides - covalently bonded together. Deoxyribonucleic Acid (DNA) - correct answer Usually a double helix made up of 2 chains of deoxyribonucleotides. Ribonucleic Acid (RNA) - correct answer Usually a singe-stranded chain of ribonucleotides. Nucleotides - correct answer These are the building blocks of nucleic acids. The contain a central sugar ring (containing an oxygen and several carbons), 1 to ...