exam 3 genetics 2024/2025 with 100% correct answers
9 vues 0 fois vendu
Cours
E3 genetics
Établissement
E3 Genetics
Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.)
CAAGGUCCCUCCCACCUAGCAA correct answ...
Based on what we learned about the most important splicing consensus sequences, what will the
sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing
occurs? (Don't write anything besides nucleotide letters.)
Which of the following Before/After statements best describes the change in scientific knowledge
brought about by the Neurospora experiments performed by Beatle & Tatum + Srb & Horowitz?
a) Before: we thought genes and proteins were colinear. After: we know that RNA splicing violates the
principle of colinearity in eukaryotes!
b) Before: we thought protein was the genetic material. After: we know DNA is the genetic material!
c) Before: we thought proteins did all the important work in a cell, while genes played minor roles. After:
we know that proteins are the products of genes!
d) Before: we thought Neurospora were auxotrophic. After: we know that Neurospora are autotrophic!
correct answersc
Imagine you're an astrobiologist trying to crack the genetic code of a microbe in another galaxy. You
isolate a mutant with a one base-pair insertion in Gene X which causes the gene to be frameshifted and
therefore nonfunctional. You then isolate a second base-pair insertion in Gene X a few nucleotides
downstream of the first mutation. When combined, these two mutations result in a functional version of
Gene X. What does this experiment reveal about the genetic code of this alien microbe?
a) The genetic code is quadruplet (words of 4 nucleotides)
b) The genetic code is triplet (words of 3 nucleotides)
c) The genetic code is doublet (words of 2 nucleotides)
d) The genetic code degenerated
e) The genetic code is universal correct answersc
,Which of the following is INCORRECT about SARS-CoV-2 RNA?
a) The - strand serves as the template for translation
Viral RNA is transcribed from an RNA template
b) The + strand is the strand that gets packaged into the virus
c) Both the + strand and the - strand are synthesized by the same enzyme
d) The - strand serves as a template for the + strand, and the + strand serves as a template for the -
strand correct answersa
Which of the following statements about how transposons violate basic laws of genetics is CORRECT.
(You may choose more than one.)
a) Transposons are post-transcriptionally stimulated by piRNAs
b) Some transposons can create additional copies of themselves at new locations in the genome
c) Some transposons can synthesize DNA from an RNA template
d) All transposons require RNA intermediates correct answersb, c
Which of the following statements about ribosomes and ribosomal RNA is NOT true?
a) The human genome has many copies of ribosomal RNA genes
b) Multiple different ribosomal RNAs are processed from a single ribosomal RNA transcript.
c) Ribosomal RNA is typically the most abundant RNA in a cell
d) Ribosomal RNA is typically the most abundant RNA in a cell correct answersd
If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA
polymerase), what would be the most likely outcome for the virus?
a) If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA
polymerase), what would be the most likely outcome for the virus?
b) The virus will be able to transcribe its RNA but unable to replicate its genome
, c) The virus will be able to replicate its genome but unable to translate its structural proteins
d) The virus will have to rely on the RNA polymerase of its eukaryotic host
e) The virus will be able to transcribe its RNA but unable to translate its structural proteins
f) The virus will be unable to replicate its genome or transcribe its RNA correct answersf
The following is a short sequence near the beginning of exon 1 of an mRNA.
5' AUG GCU AAC 3'
What will be the sequence of the anticodon (from 5' to 3', left to right) that will pair with the second
codon in the mRNA?
a) AGC
b) CAU
c) GCT
d) GCU correct answersa
Which of the following RNA molecules serves as an adapter molecule during protein synthesis?
a) tRNA
b) All of the above
c) mRNA
d) rRNA correct answersa
You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's
Yeast") that fails to transcribe your favorite gene. Which of the following is highly unlikely to contain your
mutation? (You can choose more than one.)
a) Promoter
b) TATA box
Les avantages d'acheter des résumés chez Stuvia:
Qualité garantie par les avis des clients
Les clients de Stuvia ont évalués plus de 700 000 résumés. C'est comme ça que vous savez que vous achetez les meilleurs documents.
L’achat facile et rapide
Vous pouvez payer rapidement avec iDeal, carte de crédit ou Stuvia-crédit pour les résumés. Il n'y a pas d'adhésion nécessaire.
Focus sur l’essentiel
Vos camarades écrivent eux-mêmes les notes d’étude, c’est pourquoi les documents sont toujours fiables et à jour. Cela garantit que vous arrivez rapidement au coeur du matériel.
Foire aux questions
Qu'est-ce que j'obtiens en achetant ce document ?
Vous obtenez un PDF, disponible immédiatement après votre achat. Le document acheté est accessible à tout moment, n'importe où et indéfiniment via votre profil.
Garantie de remboursement : comment ça marche ?
Notre garantie de satisfaction garantit que vous trouverez toujours un document d'étude qui vous convient. Vous remplissez un formulaire et notre équipe du service client s'occupe du reste.
Auprès de qui est-ce que j'achète ce résumé ?
Stuvia est une place de marché. Alors, vous n'achetez donc pas ce document chez nous, mais auprès du vendeur QUILLSKY. Stuvia facilite les paiements au vendeur.
Est-ce que j'aurai un abonnement?
Non, vous n'achetez ce résumé que pour €17,12. Vous n'êtes lié à rien après votre achat.
