Next Generation DNA Sequencing Exam Questions and Answers Graded A+
2 vues 0 fois vendu
Cours
Next Generation DNA Sequencing
Établissement
Next Generation DNA Sequencing
Next Generation DNA Sequencing Exam Questions and Answers Graded A+
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)->biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throug...
Next Generation DNA Sequencing Exam Questions and Answers Graded A+
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)-
>biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throughput sequencing method that allows
sequencing of a specific region of the genome (Sanger Method), low error rate, easy to anylyze-can do
manually
Next Generation Sequencing (NGS) - Answers A high-throughput sequencing method that parallelizes
the sequencing process, producing thousands or millions of sequences at once (second and third)
Third Generation Sequencing - Answers • Lower output • Longer sequences (reads) • Single molecule
sequencing; can amp 1 molecule of DNA
The Single Molecule Sequencing is uninterrupted and detected in REAL TIME- ^ error rate can correct
b/c overlapping seq-no limitation, can code entire RNA seq, current disrupted when nucleotide passes
through nanopore and is sequenced
Second Generation Sequencing - Answers • Higher output • Short sequences (reads)-shorter than
Sanger 250bp • Amplification step; costs less b/c amnt you can generate at the same time
How Sanger Method works - Answers Sanger Sequencing developed by Fred Sanger et al in 1977
Uses dideoxynucleotides for chain termination, generating fragments of different lengths ending in
ddATP, ddGTP, ddCTP or ddTTP
-normal has 3'-OH required for chain elongation; chain terminator has H
NGS: Second generation DNA Sequencing Uses - Answers Illumina, Ion Torrent, Scope
Illumina Workflow starts with which step? What happens here? - Answers Library preparation (6hr w/
3hr hands on): Genomic DNA (or RNA> cDNA) is fragmented and adapters are ligated to each fragment.
The adapters link the DNA fragments to the flowcell surface.
Fragment DNA->repair ends. add A overhang -> ligate adapters -> select ligated DNA
Illumina Workflow second step: - Answers 2) Cluster Generation (4 hrs, 5 minutes hands on, 1-96
samples): The template needs many clonal copies (clusters) to generate enough light to be recorded by
the camera! The fragments can be sequenced in both directions (Paired-end Sequencing); attach DNA to
flow cell-> perform bridge amplification->generate clusters-> anneal sequencing primer
Illumina Workflow third step: - Answers 3) Sequencing by Synthesis: Every cycle a dNTP is incorporated,
a process that starts a chemical cascade that produces light recorded by a camera. Each dNTP (A, C, G, T)
has a specific light spectrum dNTP added-> light -> identified bp
"Paired" meaning and role - Answers 'Paired-ends' refers to the two ends of the same DNA molecule
, • Genomic DNA is sheared into fragments of 300-1000 bp
• Adaptors are added to the end of each fragment
• Each fragment/molecule of DNA is sequenced from both ends
With different protocols relying on DNA circularization, long paired end libraries (mate pair) can be
generated (up to 40 Kb)
genomic DNA->fragment (200-500 bp) -> ligate adapters-> generate clusters-sequence 1st end ->
regenerate clusters & sequence paired end
Why is Paired-End important? - Answers 1 - To anchor contigs->scaffolds
Ex: contigs AGTTCCATGATACGCACGCTTACACCGACATGCG
Single-End reads CATGATACGCAAACC
Paired-End reads ATGATACGCA___CGCTTACATGC
1000bp sequenced 200 beg and end of fragment- too long other, too short, wont bridge properly (seq->
fragment -> substrate)
2 - To correctly evaluate the expression of different genes or isoforms
Gene 1
CTGATAGAGAGAGAGAGAGCTGGCTAATCACCC
Gene 2 AGAGAGAGAGAGAGATTA
Single-End reads AGAGAGAGAGAGAG
Paired-End reads AGAGAGAGAGAGAG__AATCACCC
3 - To create longer reads by overlapping
Single-End reads (100bp) ...ACACCGACATGCGA...
Paired-End reads (2 x 100bp)...ACACCGACATGCGA CGACGACATGCG...
IonTorrent sequencing (NextGen) - Answers - No Laser, Camera and Fluorescence
- Semiconductor sequencing chips produced in standard CMOS factories
- When a nucleotide is incorporated, a H+ is released and state solid PHmeter detects the voltage
difference calling the base
- Read Length: > 400bb
Les avantages d'acheter des résumés chez Stuvia:
Qualité garantie par les avis des clients
Les clients de Stuvia ont évalués plus de 700 000 résumés. C'est comme ça que vous savez que vous achetez les meilleurs documents.
L’achat facile et rapide
Vous pouvez payer rapidement avec iDeal, carte de crédit ou Stuvia-crédit pour les résumés. Il n'y a pas d'adhésion nécessaire.
Focus sur l’essentiel
Vos camarades écrivent eux-mêmes les notes d’étude, c’est pourquoi les documents sont toujours fiables et à jour. Cela garantit que vous arrivez rapidement au coeur du matériel.
Foire aux questions
Qu'est-ce que j'obtiens en achetant ce document ?
Vous obtenez un PDF, disponible immédiatement après votre achat. Le document acheté est accessible à tout moment, n'importe où et indéfiniment via votre profil.
Garantie de remboursement : comment ça marche ?
Notre garantie de satisfaction garantit que vous trouverez toujours un document d'étude qui vous convient. Vous remplissez un formulaire et notre équipe du service client s'occupe du reste.
Auprès de qui est-ce que j'achète ce résumé ?
Stuvia est une place de marché. Alors, vous n'achetez donc pas ce document chez nous, mais auprès du vendeur TutorJosh. Stuvia facilite les paiements au vendeur.
Est-ce que j'aurai un abonnement?
Non, vous n'achetez ce résumé que pour €7,81. Vous n'êtes lié à rien après votre achat.
