BIO 235 - Final Exam 2022 quetions and answer All correct
3 vues 0 fois vendu
Cours
BIO 235
Établissement
BIO 235
BIO 235 - Final Exam Study Guide
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only...
the central dogma of molecular biology states that
École, étude et sujet
BIO 235
Tous les documents sur ce sujet (255)
Vendeur
S'abonner
Classroom
Avis reçus
Aperçu du contenu
BIO 235 - Final Exam Study Guide
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses Ans: B
What is the exception to the Central Dogma rule? Ans: RETROVIRUSES (process goes from RNA to DNA
using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? Ans: Reverse transcriptase
enzymes
What category of transposable elements use an RNA copy of their genome in the process of
transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids Ans: D
Copy-and-paste transposons a.k.a. replicative transposition Ans: A new copy of the transposable
element is introduced at a new site while the old copy remains behind at the original site (so the
number of copies of the transposable element increases)
Transposons a.k.a. transposable elements Ans: Sequences that can move about in the genome and are
often a cause of mutations
Are direct repeats part of a transposon? Ans: NO
Are inverted repeats part of a transposon? Ans: YES
Transposition Ans: The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition Ans: Transposable element excises from
the old site and inserts at a new site WITHOUT any increase in the number of its copies
Retrotransposons Ans: Elements that transpose through an RNA intermediate
,Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules are called
________, whereas mutagenic compounds that cause the covalent attachment of a methyl or an ethyl
group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents Ans: C
Base analogs Ans: Chemicals with structures similar to that of any of the four standard bases of DNA
(DNA polymerase canNOT distinguish these analogs from the standard bases)
Alkylating agents Ans: Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination Ans: Removing an amino group
Intercalating agents Ans: Produce mutations by sandwiching themselves (intercalating) between
adjacent bases in DNA, distorting the three-dimensional structure of the helix and causing single-
nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? Ans: X-rays (ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? Ans: UV rays
Pyrimidine dimers Ans: Formation of a chemical bond between adjacent pyrimidine molecules on the
same strand of DNA
Depurination Ans: The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 Ans: D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation of alpha-
helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in space Ans: C
, Primary structure of a protein Ans: Sequence of amino acids
Secondary structure of a protein Ans: Interactions between neighboring amino acids causing a
polypeptide chain to fold and twist (alpha helix and beta pleated sheet - regional folding)
Tertiary structure of a protein Ans: Overall-three dimensional shape of the protein (when secondary
structures fold even further)
Quaternary structure Ans: When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may be able to anneal
to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide Ans: E (wobble takes place on the THIRD position of a codon and the FIRST
position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) Ans: 3' end (third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) Ans: 5' end (first position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
B. group of three nucleotides in DNA; codon in mRNA
C. tRNA; amino acid
D. Anticodon; codon Ans: D
The increase in number (expansion) of three-nucleotide repeats is responsible for?
A. Sickle-cell anemia
B. Xeroderma pigmentosum
C. Alkaptonuria
D. Trisomy 21
E. Fragile X syndrome
F. None of the above Ans: E
How many copies of the CGG repeat does a normal/unaffected person? (fragile X syndrome) Ans: Less
than 55 (60)
How many copies of the CGG repeat does a premutated individual have? (fragile X syndrome) Ans: 55-
230
Les avantages d'acheter des résumés chez Stuvia:
Qualité garantie par les avis des clients
Les clients de Stuvia ont évalués plus de 700 000 résumés. C'est comme ça que vous savez que vous achetez les meilleurs documents.
L’achat facile et rapide
Vous pouvez payer rapidement avec iDeal, carte de crédit ou Stuvia-crédit pour les résumés. Il n'y a pas d'adhésion nécessaire.
Focus sur l’essentiel
Vos camarades écrivent eux-mêmes les notes d’étude, c’est pourquoi les documents sont toujours fiables et à jour. Cela garantit que vous arrivez rapidement au coeur du matériel.
Foire aux questions
Qu'est-ce que j'obtiens en achetant ce document ?
Vous obtenez un PDF, disponible immédiatement après votre achat. Le document acheté est accessible à tout moment, n'importe où et indéfiniment via votre profil.
Garantie de remboursement : comment ça marche ?
Notre garantie de satisfaction garantit que vous trouverez toujours un document d'étude qui vous convient. Vous remplissez un formulaire et notre équipe du service client s'occupe du reste.
Auprès de qui est-ce que j'achète ce résumé ?
Stuvia est une place de marché. Alors, vous n'achetez donc pas ce document chez nous, mais auprès du vendeur Classroom. Stuvia facilite les paiements au vendeur.
Est-ce que j'aurai un abonnement?
Non, vous n'achetez ce résumé que pour €12,67. Vous n'êtes lié à rien après votre achat.
