Next Generation DNA Sequencing Exam Questions and Answers Graded A+
3 views 0 purchase
Course
Next Generation DNA Sequencing
Institution
Next Generation DNA Sequencing
Next Generation DNA Sequencing Exam Questions and Answers Graded A+
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)->biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throug...
Next Generation DNA Sequencing Exam Questions and Answers Graded A+
NGS Background - Answers 1990 - Lynx Therapeutics Massively Parallel Signature Sequencing (MPSS)-
>biggest revolution in molecular biology after sanger sequencing and PCR
First Generation Sequencing (FGS) - Answers A low-throughput sequencing method that allows
sequencing of a specific region of the genome (Sanger Method), low error rate, easy to anylyze-can do
manually
Next Generation Sequencing (NGS) - Answers A high-throughput sequencing method that parallelizes
the sequencing process, producing thousands or millions of sequences at once (second and third)
Third Generation Sequencing - Answers • Lower output • Longer sequences (reads) • Single molecule
sequencing; can amp 1 molecule of DNA
The Single Molecule Sequencing is uninterrupted and detected in REAL TIME- ^ error rate can correct
b/c overlapping seq-no limitation, can code entire RNA seq, current disrupted when nucleotide passes
through nanopore and is sequenced
Second Generation Sequencing - Answers • Higher output • Short sequences (reads)-shorter than
Sanger 250bp • Amplification step; costs less b/c amnt you can generate at the same time
How Sanger Method works - Answers Sanger Sequencing developed by Fred Sanger et al in 1977
Uses dideoxynucleotides for chain termination, generating fragments of different lengths ending in
ddATP, ddGTP, ddCTP or ddTTP
-normal has 3'-OH required for chain elongation; chain terminator has H
NGS: Second generation DNA Sequencing Uses - Answers Illumina, Ion Torrent, Scope
Illumina Workflow starts with which step? What happens here? - Answers Library preparation (6hr w/
3hr hands on): Genomic DNA (or RNA> cDNA) is fragmented and adapters are ligated to each fragment.
The adapters link the DNA fragments to the flowcell surface.
Fragment DNA->repair ends. add A overhang -> ligate adapters -> select ligated DNA
Illumina Workflow second step: - Answers 2) Cluster Generation (4 hrs, 5 minutes hands on, 1-96
samples): The template needs many clonal copies (clusters) to generate enough light to be recorded by
the camera! The fragments can be sequenced in both directions (Paired-end Sequencing); attach DNA to
flow cell-> perform bridge amplification->generate clusters-> anneal sequencing primer
Illumina Workflow third step: - Answers 3) Sequencing by Synthesis: Every cycle a dNTP is incorporated,
a process that starts a chemical cascade that produces light recorded by a camera. Each dNTP (A, C, G, T)
has a specific light spectrum dNTP added-> light -> identified bp
"Paired" meaning and role - Answers 'Paired-ends' refers to the two ends of the same DNA molecule
, • Genomic DNA is sheared into fragments of 300-1000 bp
• Adaptors are added to the end of each fragment
• Each fragment/molecule of DNA is sequenced from both ends
With different protocols relying on DNA circularization, long paired end libraries (mate pair) can be
generated (up to 40 Kb)
genomic DNA->fragment (200-500 bp) -> ligate adapters-> generate clusters-sequence 1st end ->
regenerate clusters & sequence paired end
Why is Paired-End important? - Answers 1 - To anchor contigs->scaffolds
Ex: contigs AGTTCCATGATACGCACGCTTACACCGACATGCG
Single-End reads CATGATACGCAAACC
Paired-End reads ATGATACGCA___CGCTTACATGC
1000bp sequenced 200 beg and end of fragment- too long other, too short, wont bridge properly (seq->
fragment -> substrate)
2 - To correctly evaluate the expression of different genes or isoforms
Gene 1
CTGATAGAGAGAGAGAGAGCTGGCTAATCACCC
Gene 2 AGAGAGAGAGAGAGATTA
Single-End reads AGAGAGAGAGAGAG
Paired-End reads AGAGAGAGAGAGAG__AATCACCC
3 - To create longer reads by overlapping
Single-End reads (100bp) ...ACACCGACATGCGA...
Paired-End reads (2 x 100bp)...ACACCGACATGCGA CGACGACATGCG...
IonTorrent sequencing (NextGen) - Answers - No Laser, Camera and Fluorescence
- Semiconductor sequencing chips produced in standard CMOS factories
- When a nucleotide is incorporated, a H+ is released and state solid PHmeter detects the voltage
difference calling the base
- Read Length: > 400bb
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller TutorJosh. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $7.99. You're not tied to anything after your purchase.
