Exam (elaborations)
MIP 300 Final exam with Answers to Questions
- Course
- Institution
MIP 300 Final exam with Answers to Questions
[Show more]
Seller
Follow
Content preview
MIP 300 Final exam with Answers to Questionsa patient can do these at normal levels: neutralize a parasitic worm, phagoctize
microbes and fix complement. However the patient cannot activate CTLs at a normal
level. What part of the immune system does this patient most likely have deficiency in? -
✔✔class I MHC
you find a bacterium in a volcano that needs to translate an mRNA that will create a 190
amino acid protein before post-translational modification. How many glucose molecules
will he need to eat via anaerobic respiration to produce enough ATP/GTP to synthesize
one molecule of this protein? - ✔✔more than 15
people with HIV have no functional CD4+ T cells. what would you expect the immune
system in these individuals to no longer be able to do? - ✔✔activate macrophages
to be more hostile
-generate plasma cells and memory B cells through clonal selection
-generate CTLs through clonal selection to kill virus infected cells and tumor cells
how do you reach herd immunity? - ✔✔by getting vaccinated or infected
a new virus surface protein has been altered so greatly tha it can now bind to
human host cells. This is an example of: - ✔✔antigenic shift
,mRNA sequence of: "5'UCAUUCGCCCGAAACCAAAUGAG"
DNA template will be - ✔✔3' AGTAAGCGGGCTTT..."
who provides the lipids in a viral envelope - ✔✔the cell
all viruses have a protein coat - ✔✔true
a virulent phage can inadvertently package host cell chromosome into phage particles
- ✔✔true
you have a bacterium that picks up a new gene by Hfr conjugation. what is an
explanation of why progeny of this bacterium express this trait? - ✔✔the gene
is integrated into the genome
after successful transformation of a fragment of chromosomal DNA, the recipient
(female) will become a donor (male) capable of creating a sex pili to transfer DNA -
✔✔false
you isolate a virulent page. It can perform specialized transduction - ✔✔false
you want to know if a baby still has vaccine neutralizing antibody that it received from
its mom in utero. Which of the following types of ELISAs would you run? one that
tests for - ✔✔IgG
in differential centrifugation, virus is first centrifuged at a slow speed, the supernatant
is removed and re-centrifuged at a very fast speed - ✔✔true
Virus stocks prepared by differential centrifugation and gradient centrifugation
are equally clean - ✔✔false
, hemagglutination assay - ✔✔determines highest dilution of virus that causes
red blood cells to clump together
cytopathic effect - ✔✔a visible effect on a host cell, caused by a virus, that may
result in host cell damage or death
immuno fluorescence assay - ✔✔primarily on biological samples and is
classically defined as a procedure to detect antigens in cellular contexts using
antibodies.
plaque assay - ✔✔method used to measure the number of viral particles present in
a sample
a temperate phage can inadvertently package host cell chromosome into phage
particles - ✔✔true
you isolate a bacterium that can transfer genes to other bacteria only when it is in
direct contact with these bacteria. it is most likely transferring the genes by -
✔✔conjugation
a piece of host cell dna bound to a piece of phage dna after excising from the
chromosome. when this phage that contains host cell dna infects a new cell, will
the new cell be killed by this infection? - ✔✔no
after successful generalized transduction, the recipient (female) will become a
donor (male) capable of creating a sex pili to transfer dna - ✔✔false
can a temperate phage perform generalized and specialized transduction? - ✔✔yes
The benefits of buying summaries with Stuvia:
Guaranteed quality through customer reviews
Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.
Quick and easy check-out
You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.
Focus on what matters
Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!
Frequently asked questions
What do I get when I buy this document?
You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.
Satisfaction guarantee: how does it work?
Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.
Who am I buying these notes from?
Stuvia is a marketplace, so you are not buying this document from us, but from seller KenAli. Stuvia facilitates payment to the seller.
Will I be stuck with a subscription?
No, you only buy these notes for $13.49. You're not tied to anything after your purchase.
Can Stuvia be trusted?
4.6 stars on Google & Trustpilot (+1000 reviews)
82191 documents were sold in the last 30 days
Founded in 2010, the go-to place to buy study notes for 14 years now