100% satisfaction guarantee Immediately available after payment Both online and in PDF No strings attached
logo-home
ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE $10.99   Add to cart

Exam (elaborations)

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

2 reviews
 9 views  0 purchase
  • Course
  • ASCP
  • Institution
  • ASCP

ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE

Preview 3 out of 28  pages

  • May 15, 2024
  • 28
  • 2023/2024
  • Exam (elaborations)
  • Questions & answers
  • ASCP
  • ASCP

2  reviews

review-writer-avatar

By: RegisteredNurse • 1 month ago

It is detailed, quality information and I passed

review-writer-avatar

By: RegisteredNurse • 4 months ago

The content provided is top-notch and worth every penny. I highly recommend.

avatar-seller
DrBellaPhD
ASCP PRACTICE EXAM QUESTIONS LATEST UPDATED VERIFIED GUARANTEED PASS 2023/2024 ACCURATE Mutation in what gene is associated with Fragile X syndrome? FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments Okazaki fragments What gene is mea sured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second 50 nucleotides per se cond This polymerase is involved in "replicates mitochondrial DNA": Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow -up visit. The physician suspects a single -
gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation -specific PCR Standard PCR PFGE RAPD PCR Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC -70ºC Consider a hypothetical mutation involving gene X. Let's say you a mplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 7 5°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? DNA Ligase Next Generation Sequencing set -up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polym erase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, conf irming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y 1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be use d in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C 58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta -globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a

The benefits of buying summaries with Stuvia:

Guaranteed quality through customer reviews

Guaranteed quality through customer reviews

Stuvia customers have reviewed more than 700,000 summaries. This how you know that you are buying the best documents.

Quick and easy check-out

Quick and easy check-out

You can quickly pay through credit card or Stuvia-credit for the summaries. There is no membership needed.

Focus on what matters

Focus on what matters

Your fellow students write the study notes themselves, which is why the documents are always reliable and up-to-date. This ensures you quickly get to the core!

Frequently asked questions

What do I get when I buy this document?

You get a PDF, available immediately after your purchase. The purchased document is accessible anytime, anywhere and indefinitely through your profile.

Satisfaction guarantee: how does it work?

Our satisfaction guarantee ensures that you always find a study document that suits you well. You fill out a form, and our customer service team takes care of the rest.

Who am I buying these notes from?

Stuvia is a marketplace, so you are not buying this document from us, but from seller DrBellaPhD. Stuvia facilitates payment to the seller.

Will I be stuck with a subscription?

No, you only buy these notes for $10.99. You're not tied to anything after your purchase.

Can Stuvia be trusted?

4.6 stars on Google & Trustpilot (+1000 reviews)

73314 documents were sold in the last 30 days

Founded in 2010, the go-to place to buy study notes for 14 years now

Start selling
$10.99
  • (2)
  Add to cart